WRITINGSHARE

A research group has sequenced the cDNA and genomic DNA

A research group has sequenced the cDNA and genomic DNA from a particular gene. The cDNA is derived from mRNA, so it does not contain introns. Here are the DNA sequences.
cDNA:
5′-ATTGCATCCAGCGTATACTATCTCGGGCCCAATTAATGCCAGCGGCCAGACTATCACCCAACTCGGTTACCTACTAGTATATCCCATATACTAGCATATATTTTACCC TAATTTGTGTGTGGGTATA-CAGTATAATCATATA-3′
Genomic DNA (contains one intron):
5′-ATTGCATCCAGCGTATACTATCTCGGGCCCAATTAATGCCAGCGGCCAGACTA CACCCAACTCGGCCCACCCCCCAGGTTTACACAGTCATACCATACATACAAAAATCGCAGTTACTTATCCCAAAAAAACCTAGATACCCCACATACTATTAACTCTTTCTTTCTAGGTTACCTACTAGTATATCCCATATACTAGCATATATTTTACCCATAATTTGTGTGTGGGTATACAGTATAATCATATA-3′
Indicate where the intron is located. Does the intron contain the normal consensus splice site sequences based on those described in Figure 12.21? Underline the splice site sequences, and indicate whether or not they fit the consensus sequence.

Check before you submit. Get Turnitin Score Report in 15 Minutes.

Don't risk the 'Red' score. Get the exact same Turnitin report your professor uses. Join 50,000+ students who submitted their essays with confidence this semester.

Get Quick Assignment Writing Help – No Plagiarism Guarantee!

Online assignment writing service website that provide university students with original and quality academic essays, term papers, admission essays, annotated bibliographies, reports, scholarship essays, personal statements, research proposals, research papers, projects, presentations, dissertation, theses, movie reviews, Book reviews, application papers, among others.

Having trouble with a homework question? Our skilled assignment writers are here to provide answers to all types of queries, ranging from fundamental mathematics to cutting-edge rocket science!

PLACE YOUR ORDER
Share your love