A research group has sequenced the cDNA and genomic DNA from a particular gene. The cDNA is derived from mRNA, so it does not contain introns. Here are the DNA sequences.
cDNA:
5′-ATTGCATCCAGCGTATACTATCTCGGGCCCAATTAATGCCAGCGGCCAGACTATCACCCAACTCGGTTACCTACTAGTATATCCCATATACTAGCATATATTTTACCC TAATTTGTGTGTGGGTATA-CAGTATAATCATATA-3′
Genomic DNA (contains one intron):
5′-ATTGCATCCAGCGTATACTATCTCGGGCCCAATTAATGCCAGCGGCCAGACTA CACCCAACTCGGCCCACCCCCCAGGTTTACACAGTCATACCATACATACAAAAATCGCAGTTACTTATCCCAAAAAAACCTAGATACCCCACATACTATTAACTCTTTCTTTCTAGGTTACCTACTAGTATATCCCATATACTAGCATATATTTTACCCATAATTTGTGTGTGGGTATACAGTATAATCATATA-3′
Indicate where the intron is located. Does the intron contain the normal consensus splice site sequences based on those described in Figure 12.21? Underline the splice site sequences, and indicate whether or not they fit the consensus sequence.
Need Help Writing an Essay?
Our team of talented writers is ready to assist. We offer essay writing help in over 75 disciplines, ensuring a convenient and comprehensive solution for all your academic needs!
Get Help Now!Get Quick Assignment Writing Help – No Plagiarism Guarantee!
Online assignment writing service website that provide university students with original and quality academic essays, term papers, admission essays, annotated bibliographies, reports, scholarship essays, personal statements, research proposals, research papers, projects, presentations, dissertation, theses, movie reviews, Book reviews, application papers, among others.
Having trouble with a homework question? Our skilled assignment writers are here to provide answers to all types of queries, ranging from fundamental mathematics to cutting-edge rocket science!
